2021-06-17 General

Vaccines

The US just donated 1M Moderna doses to Canada.


Canada received 330K Johnson & Johnson doses, but it’s going to sit on them right now because of concerns about contamination. Canada will also refuse any more J&J shipments.


Today NACI advised Team AZ to get mRNA for the second dose. While I think this is the correct thing to do, I am really puzzled by the timing.

Me, I formed my opinion on mixing vax being preferable to matching vax from a data science background. It sure seems like mixing should be better, but if NACI just wanted to go on a “well, by analogy, mixing should be better” platform, they could have done that years ago. If they decided that the antibody studies were good enough, they could have done that a month ago. Finally, there are no new studies of AZ+Pfizer (“Pfazer”) vs. AZ+AZ (AZ^2) that I have heard of.

There are lots of time in the real world where people are quite confident in something which turns out not to be the case. (Many smart people thought that CureVac would be a great vaccine, for example.) So it seems irresponsible to me for NACI to make this recommendation without evidence from humans in the wild.

And I don’t think NACI is irresponsible or incompetent. Thus I bet what happened is that the UK mix&match researchers quietly leaked their results to NACI, and those results show unambiguously that Pfazer is better than AZ^2.

Or maybe it’s as simple as “we have tons of mRNA now”?


This blog posting looks at the CureVac disaster. CureVac has been trying to explain away their vaccine’s dismal effectivity as being due to variants, but this blogger is having none of it. In the wild, the other mRNA vaxes are doing just fine, thank you very much. He thinks it is most likely that it’s because CureVac went “natural” while Pfizer/Moderna (Pfizerna? Moder?) substituted some artificial letters into their mRNA strings.

Quick explanation: DNA/RNA strings are made up of five “letters”: C, A, G, T. Each letter is actually a little molecule, but scientists use shorthands to talk about them so that they can represent DNA strings compactly, like GAGAATAAACTAGTATTCTTCTG etc.

The machinery which reads the DNA/RNA is a little forgiving, and there are some molecules you can swap in which the cellular machinery will read as perfectly fine letters. It’s sort of like if I swap in the Greek character tau (τ) for the Latin t: you’d still be able to read “τhe caτ saτ on τhe maτ”.

However, the immune system doesn’t recognize molecules containing these artificial letters as being Bad Things Which Must Be Destroyed. (There are a number of viruses which are mRNA viruses, so the immune system is on guard against random pieces of mRNA skulking around. It’s likely that any mRNA wandering around outside of the cells is likely to be a baddie, intent on hijacking the cellular machinery for its own nefarious aims.)

The CureVac vaccine (probably, frequently) gets jumped and destroyed by the immune system, which thinks — correctly — that the mRNA wants to hijack the cellular machinery.

Pfizer/Moderna vaccines, however, substitute artificial molecules for two of the letters, so they can brazenly walk right past the immune system and infiltrate the cells. There they hijack the cellular machinery for their own nefarious purpose: to make lots of spike proteins to train the immune system.

Now: why the hell didn’t CureVac do substitutions????? Welllll remember that nobody had ever made an mRNA vaccine before. We didn’t know what was going to work. “We got lucky” that the Pfizer/Moderna vaxes are so FREAKING amazing, but part of that “getting lucky” was taking a lot of shots on goal. Some vaccines worked, some didn’t, and we are enjoying the ones that worked.

(For more on the “source code” of the vaccines, see this awesome article.)

This tweet speculates that the amount of mRNA in the dose was smaller.


This article reports on how the immune response from infection is much more variable than from a vaccination. Get the vax, even if you were sick!


This preprint says that a vaccine, administered nasally, successfully protected some Syrian golden hamsters completely from B.1.1.7 and B.1.351 VOCs. This vaccine uses what I call the “spiky ball” approach, where there’s a little nanoparticle ball with COVID-19 spikes on it. (Novavax also uses the spiky ball approach.)

One nice feature of the spiky ball approach is that you can put spikes from lots of different coronaviruses on each ball. In this case, it used B.1.1.7 and B.1.351 spikes. I believe the plan is to also put spikes from SARS-CoV-1, MERS, and maybe even some common-cold coronaviruses on the ball as well.

Variants

This preprint says that Delta isn’t that vax-evasive, and that Beta and Gamma are different enough from Delta, and that Beta/Gamma resistance (either from getting sick with Beta or Gamma or from a vaccine targeting with Beta or Gamma, like Moderna’s M1a) won’t necessarily protect you against Delta.

Long COVID

This preprint points out the sample bias problems and/or improper controls with most Long COVID studies: taking subjects from Long COVID support groups, comparing mild to severe COVID patients, etc.

The authors did a very careful test with controls and found that mental-health, gastrointestinal and dermatological symptoms in people who tested positive for COVID-19 and had mild-to-moderate symptoms wasn’t actually that different from people who always tested negative for COVID-19. (Basically, the pandemic sucked for everyone’s mental, GI, and dermatological health.)

However, there were clusters of other symptoms — neurological, sensory, and cardiorespiratory — which COVID patients had a higher risk of. Note that these clusters were also present in the controls (wtf? the pandemic is really hard on everyone?) but were more prevalent in the people who had tested positive for COVID.

This paper gave an estimate for long COVID in the UK for 2.2% to 13.7% , which is lower than I’d heard before.

The fact that so many people who never tested positive had Long COVID symptoms makes me wonder if there is something else which the pandemic exposed us to. For example, maybe more people got sick from household mold exposure because people stayed home more?

Recommended Reading

This article on problems at the US CDC is interesting. For example, it talks about re-opening schools and makes me think that BC probably did it right. Warning: long, and very US-centric.

1 comment

Leave a comment

Your email address will not be published. Required fields are marked *